shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Prr13-shRNA-Seq1)(CAT#: AdV-SI4013WQ)

This product is a Prr13-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Prr13 gene may negatively regulate TSP1 expression at the level of transcription. The expression of Prr13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Prr13-shRNA-Seq1
Related Target/Protein Prr13
Region CDS
TargetSeq GAAGTCGCACAAGCATCACAA
NCBI RefSeq NM_025385
Alternative Names TXR1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54458
Uniprot ID Q9NZ81

Related Products

Advertisement