shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(2210407C18Rik-shRNA-Seq1)(CAT#: AdV-SI3094WQ)

This product is a 2210407C18Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 2210407C18Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 2210407C18Rik-shRNA-Seq1
Related Target/Protein 2210407C18Rik
Region CDS
TargetSeq GTTATTCTGCTTCTCCAGAAA
NCBI RefSeq NM_144544
Alternative Names Ep1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 78354
Uniprot ID Q6YI28

Related Products