shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C3orf15-shRNA-Seq1)(CAT#: AdV-SI0959WQ)
This product is a C3orf15-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C3orf15 gene may play a role in spermatogenesis and regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C3orf15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | C3orf15-shRNA-Seq1 |
Related Target/Protein | C3orf15 |
Region | CDS |
TargetSeq | CAAGGCAGAACCATACACTTT |
NCBI RefSeq | NM_033364 |
Alternative Names | AAT1; CFAP91; MAATS1; CaM-IP2; SPATA26; AAT1alpha |
Titer | >1*10^10 GC/mL |
Related Diseases | Kartagener syndrome |