shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(CABIN1-shRNA-Seq1)(CAT#: AdV-SI0227WQ)
This product is a CABIN1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by CABIN1 gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The expression of CABIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CABIN1-shRNA-Seq1 |
| Related Target/Protein | CABIN1 |
| Region | CDS |
| TargetSeq | CCAGCACTATAAGAGTCTCTA |
| NCBI RefSeq | NM_012295 |
| Alternative Names | CAIN; PPP3IN; KB-318B8.7 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Glomerular podocyte injury |
