shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Csrnp1-shRNA-Seq3)(CAT#: AdV-SI2616WQ)
This product is a Csrnp1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Csrnp1 gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The expression of Csrnp1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Csrnp1-shRNA-Seq3 |
Related Target/Protein | Csrnp1 |
Region | 3UTR |
TargetSeq | GTTTATGGCTGCTCTATTAAA |
NCBI RefSeq | NM_153287 |
Alternative Names | AXUD1; URAX1; TAIP-3; CSRNP-1; FAM130B |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |