shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Arl10-shRNA-Seq1)(CAT#: AdV-SI2248WQ)

This product is a Arl10-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Arl10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Arl10-shRNA-Seq1
Related Target/Protein Arl10
Region CDS
TargetSeq CTTTATCCTCTGGAAAGCTTA
NCBI RefSeq NM_019968
Alternative Names ARL10A
Titer >1*10^10 GC/mL
Related Diseases Chromosome segregation
Target Gene
Gene ID 285598
Uniprot ID Q8N8L6

Related Products