shRNA Lentivirus (self-inactivating), p7SK-(Rufy2-shRNA-Seq1)(CAT#: LV-SI3643WQ)

This product is a Rufy2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Rufy2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Rufy2-shRNA-Seq1
Related Target/Protein Rufy2
Region CDS
TargetSeq GCTATCAGTACAAGTTGGCAT
NCBI RefSeq NM_027425
Alternative Names RABIP4R; ZFYVE13
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55680
Uniprot ID Q8WXA3

Related Products