shRNA Lentivirus (self-inactivating), pH1-(RPRM-shRNA-Seq2)(CAT#: LV-SI0912WQ)

This product is a RPRM-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The RPRM gene may be involved in the regulation of p53-dependent G2 arrest of the cell cycle. The expression of RPRM-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert RPRM-shRNA-Seq2
Related Target/Protein RPRM
Region 3UTR
TargetSeq GAACTTTGGAAGCTGCTACTT
NCBI RefSeq NM_019845
Alternative Names REPRIMO
Titer >1*10^10 GC/mL
Related Diseases Lung carcinoma
Target Gene
Gene ID 56475
Uniprot ID Q9NS64

Related Products