shRNA Lentivirus (self-inactivating), pH1-(BC052040-shRNA-Seq1)(CAT#: LV-SI3193WQ)

This product is a BC052040-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of BC052040-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert BC052040-shRNA-Seq1
Related Target/Protein BC052040
Region CDS
TargetSeq CCACCCTCCAAGTCTGTTATA
NCBI RefSeq NM_207264
Titer >1*10^10 GC/mL
Target Gene
Gene ID 399568
Uniprot ID E9PWV4

Related Products