shRNA Lentivirus (self-inactivating), pH1-(HOOK2-shRNA-Seq2)(CAT#: LV-SI2468WQ)

This product is a HOOK2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The HOOK2 gene encodes a member of Hook proteins that are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The expression of HOOK2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert HOOK2-shRNA-Seq2
Related Target/Protein HOOK2
Region CDS
TargetSeq GCTATTTGAATGCCGCAACCT
NCBI RefSeq NM_013312
Alternative Names HK2
Titer >1*10^10 GC/mL
Related Diseases Obesity and type 2 diabetes
Target Gene
Gene ID 29911
Uniprot ID Q96ED9

Related Products