shRNA Lentivirus (self-inactivating), pH1-(C10orf67-shRNA-Seq2)(CAT#: LV-SI0768WQ)

This product is a C10orf67-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C10orf67-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C10orf67-shRNA-Seq2
Related Target/Protein C10orf67
Region CDS
TargetSeq CATTATCAACAGAATGAGGAT
NCBI RefSeq NM_153714
Alternative Names C10orf115; LINC01552
Titer >1*10^10 GC/mL
Related Diseases Sarcoidosis and Crohn's disease
Target Gene
Gene ID 256815
Uniprot ID Q8IYJ2

Related Products