shRNA Lentivirus (self-inactivating), pH1-(SAMD13-shRNA-Seq2)(CAT#: LV-SI0951WQ)
This product is a SAMD13-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of SAMD13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SAMD13-shRNA-Seq2 |
Related Target/Protein | SAMD13 |
Region | CDS |
TargetSeq | GATGTCGTCAATTATTTCCGA |
NCBI RefSeq | NM_001010971 |
Alternative Names | HSD-41; HSD-42 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast Cancer |