shRNA Lentivirus (self-inactivating), pU6-(APBA3-shRNA-Seq1)(CAT#: LV-SI0311WQ)

This product is a APBA3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by APBA3 gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. The expression of APBA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert APBA3-shRNA-Seq1
Related Target/Protein APBA3
Region CDS
TargetSeq CTATGGCGAGGTGCATATCAA
NCBI RefSeq NM_004886
Alternative Names X11L2; mint3; MGC:15815
Titer >1*10^10 GC/mL
Related Diseases Alzheimer's disease
Target Gene
Gene ID 9546
Uniprot ID O96018

Related Products