shRNA Lentivirus (self-inactivating), pU6-(Mrpl53-shRNA-Seq1)(CAT#: LV-SI1875WQ)
This product is a Mrpl53-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Mrpl53 gene may help in protein synthesis within the mitochondrion. The expression of Mrpl53-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Mrpl53-shRNA-Seq1 |
| Related Target/Protein | Mrpl53 |
| Region | 3UTR |
| TargetSeq | GAAGAGTCCAACAACCAAATG |
| NCBI RefSeq | NM_026744 |
| Alternative Names | L53MT |
| Titer | >1*10^10 GC/mL |
