shRNA Lentivirus (self-inactivating), pU6-(N4bp2-shRNA-Seq2)(CAT#: LV-SI1924WQ)

This product is a N4bp2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by N4bp2 gene binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. The expression of N4bp2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert N4bp2-shRNA-Seq2
Related Target/Protein N4bp2
Region CDS
TargetSeq CTCCAGTAATCATAGATAATA
NCBI RefSeq NM_001024917
Alternative Names B3BP
Titer >1*10^10 GC/mL
Related Diseases B-cell leukemia/lymphoma
Target Gene
Gene ID 55728
Uniprot ID Q86UW6

Related Products