shRNA Lentivirus (self-inactivating), pU6-(OR4S2-shRNA-Seq4)(CAT#: LV-SI2131WQ)

This product is a OR4S2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR4S2 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR4S2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR4S2-shRNA-Seq4
Related Target/Protein OR4S2
Region CDS
TargetSeq CCCAAATTAATGGTTGACTTA
NCBI RefSeq XM_166871
Alternative Names OR4S2P; OST725; OR11-137
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 219431
Uniprot ID Q8NH73

Related Products