shRNA Lentivirus (self-inactivating), pH1-(FAM36A-shRNA-Seq1)(CAT#: LV-SI0999WQ)
This product is a FAM36A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The FAM36A gene encodes a protein that plays a role in the assembly of cytochrome C oxidase, an important component of the respiratory pathway. The expression of FAM36A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | FAM36A-shRNA-Seq1 |
Related Target/Protein | FAM36A |
Region | CDS |
TargetSeq | CTTTGGGATGCTGGTTTCATT |
NCBI RefSeq | NM_198076 |
Alternative Names | COX20 |
Titer | >1*10^10 GC/mL |
Related Diseases | Mitochondrial complex IV deficiency |