shRNA Lentivirus (self-inactivating), pH1-(FAM36A-shRNA-Seq1)(CAT#: LV-SI0999WQ)
This product is a FAM36A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The FAM36A gene encodes a protein that plays a role in the assembly of cytochrome C oxidase, an important component of the respiratory pathway. The expression of FAM36A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | FAM36A-shRNA-Seq1 |
| Related Target/Protein | FAM36A |
| Region | CDS |
| TargetSeq | CTTTGGGATGCTGGTTTCATT |
| NCBI RefSeq | NM_198076 |
| Alternative Names | COX20 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mitochondrial complex IV deficiency |
