shRNA Lentivirus (self-inactivating), pU6-(Pppde1-shRNA-Seq2)(CAT#: LV-SI1972WQ)
This product is a Pppde1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Pppde1 gene has deubiquitinating activity. The expression of Pppde1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Pppde1-shRNA-Seq2 |
Related Target/Protein | Pppde1 |
Region | CDS |
TargetSeq | GAGCTAGGAGAAACATTTAAA |
NCBI RefSeq | NM_024282 |
Alternative Names | DESI; DESI1; DeSI-2; PNAS-4; PPPDE1; CGI-146; FAM152A; C1orf121; DESI2 |
Titer | >1*10^10 GC/mL |