shRNA Lentivirus (self-inactivating), pU6-(Pppde1-shRNA-Seq2)(CAT#: LV-SI1972WQ)

This product is a Pppde1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Pppde1 gene has deubiquitinating activity. The expression of Pppde1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Pppde1-shRNA-Seq2
Related Target/Protein Pppde1
Region CDS
TargetSeq GAGCTAGGAGAAACATTTAAA
NCBI RefSeq NM_024282
Alternative Names DESI; DESI1; DeSI-2; PNAS-4; PPPDE1; CGI-146; FAM152A; C1orf121; DESI2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 51029
Uniprot ID Q9BSY9

Related Products