shRNA Adeno-associated Virus Serotype 2, pH1-(Adipor1-shRNA-Seq1)(CAT#: AAV-SI2683WQ)
This product is a Adipor1-shRNA encoding AAV, which is based on AAV-2 serotype. The Adipor1 gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. The expression of Adipor1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Adipor1-shRNA-Seq1 |
Related Target/Protein | Adipor1 |
Region | CDS |
TargetSeq | GACAACGACTACCTGCTACAT |
NCBI RefSeq | NM_028320 |
Alternative Names | CGI45; PAQR1; ACDCR1; CGI-45; TESBP1A |
Titer | >1*10^10 GC/mL |
Related Diseases | Obesity; Diabetes |