shRNA Adeno-associated Virus Serotype 2, pU6-(DPY19L4-shRNA-Seq4)(CAT#: AAV-SI2191WQ)

This product is a DPY19L4-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DPY19L4 gene is probable C-mannosyltransferase that mediates C-mannosylation of tryptophan residues on target proteins. The expression of DPY19L4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DPY19L4-shRNA-Seq4
Related Target/Protein DPY19L4
Region CDS
TargetSeq GCGATTGACACAGTCTTCTTT
NCBI RefSeq NM_181787
Titer >1*10^10 GC/mL
Target Gene
Gene ID 286148
Uniprot ID Q7Z388

Related Products