shRNA Adeno-associated Virus Serotype 2, pU6-(DPY19L4-shRNA-Seq4)(CAT#: AAV-SI2191WQ)
This product is a DPY19L4-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DPY19L4 gene is probable C-mannosyltransferase that mediates C-mannosylation of tryptophan residues on target proteins. The expression of DPY19L4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | DPY19L4-shRNA-Seq4 |
Related Target/Protein | DPY19L4 |
Region | CDS |
TargetSeq | GCGATTGACACAGTCTTCTTT |
NCBI RefSeq | NM_181787 |
Titer | >1*10^10 GC/mL |