shRNA Adeno-associated Virus Serotype 2, pU6-(KHDRBS1-shRNA-Seq1)(CAT#: AAV-SI0044WQ)
This product is a KHDRBS1-shRNA encoding AAV, which is based on AAV-2 serotype.The KHDRBS1 encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. The expression of KHDRBS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | KHDRBS1-shRNA-Seq1 |
Related Target/Protein | KHDRBS1 |
Region | 3UTR |
TargetSeq | GTTCCCAAGTTAGTCAAGTAT |
NCBI RefSeq | NM_006559 |
Alternative Names | p62; p68; Sam68 |
Titer | >1*10^10 GC/mL |
Related Diseases | Primary ovarian insufficiency |