shRNA Adeno-associated Virus Serotype 2, pU6-(Zfp414-shRNA-Seq1)(CAT#: AAV-SI2231WQ)
This product is a Zfp414-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Zfp414 gene may be involved in transcriptional regulation. The expression of Zfp414-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Zfp414-shRNA-Seq1 |
Related Target/Protein | Zfp414 |
Region | CDS |
TargetSeq | GTTCGTGATCTAGCACAGCAT |
NCBI RefSeq | NM_026712 |
Alternative Names | Znf414; 0610030H11Rik |
Titer | >1*10^10 GC/mL |