shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CHRDL2-shRNA-Seq3)(CAT#: AdV-SI2378WQ)

This product is a CHRDL2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The CHRDL2 gene encodes a member of the chordin family of proteins. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. The expression of CHRDL2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert CHRDL2-shRNA-Seq3
Related Target/Protein CHRDL2
Region CDS
TargetSeq CAGGAAGCAAGACTTCCAGAA
NCBI RefSeq NM_015424
Alternative Names BNF1; CHL2
Titer >1*10^10 GC/mL
Related Diseases osteoarthritis
Target Gene
Gene ID 25884
Uniprot ID Q6WN34

Related Products