shRNA Lentivirus (self-inactivating), pH1-(TMEM167B-shRNA-Seq1)(CAT#: LV-SI2354WQ)
This product is a TMEM167B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by TMEM167B nvolved in the early part of the secretory pathway. The expression of TMEM167B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | TMEM167B-shRNA-Seq1 |
Related Target/Protein | TMEM167B |
Region | CDS |
TargetSeq | GCAATTGCTTGTGTTGTAATG |
NCBI RefSeq | NM_020141 |
Alternative Names | AD-020; C1orf119 |
Titer | >1*10^10 GC/mL |
Related Diseases | Prostate cancer |