shRNA Adeno-associated Virus Serotype 2, p7SK-(BOD1-shRNA-Seq2)(CAT#: AAV-SI1187WQ)
This product is a BOD1-shRNA encoding AAV, which is based on AAV-2 serotype. The BOD1 gene is required for proper chromosome biorientation through the detection or correction of syntelic attachments in mitotic spindles. The expression of BOD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | BOD1-shRNA-Seq2 |
| Related Target/Protein | BOD1 |
| Region | 3UTR |
| TargetSeq | CCAGTTTCCTTTCCTTTGTAA |
| NCBI RefSeq | NM_138369 |
| Alternative Names | FAM44B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |
