shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(FAM53C-shRNA-Seq2)(CAT#: AdV-SI3222WQ)
This product is a FAM53C-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by FAM53C gene belongs to the FAM53 protein family. FAM53 protein family members bind to a transcriptional regulator that modulates cell proliferation. Alternative splicing results in multiple transcript variants. The expression of FAM53C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | FAM53C-shRNA-Seq2 |
| Related Target/Protein | FAM53C |
| Region | CDS |
| TargetSeq | GACTTGAATTTGATTGAGGAA |
| NCBI RefSeq | NM_016605 |
| Alternative Names | C5orf6 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Prostate cancer |
