shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Fchsd1-shRNA-Seq2)(CAT#: AdV-SI3584WQ)
This product is a Fchsd1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Fchsd1 gene may promotes actin polymerization mediated by SNX9 and WASL. The expression of Fchsd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Fchsd1-shRNA-Seq2 |
Related Target/Protein | Fchsd1 |
Region | 3UTR |
TargetSeq | CGGATTTATTGACAGTGAATA |
NCBI RefSeq | NM_175684 |
Alternative Names | NWK2 |
Titer | >1*10^10 GC/mL |