shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(NSMAF-shRNA-Seq4)(CAT#: AdV-SI3412WQ)
This product is a NSMAF-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The NSMAF gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor and may play a role in regulating TNF-induced cellular responses such as inflammation. The expression of NSMAF-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | NSMAF-shRNA-Seq4 |
| Related Target/Protein | NSMAF |
| Region | CDS |
| TargetSeq | GAGTACTACTTTGAACAGCAT |
| NCBI RefSeq | NM_003580 |
| Alternative Names | FAN; GRAMD5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Inflammation |
