shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PLEKHA6-shRNA-Seq1)(CAT#: AdV-SI1389WQ)

Datasheet

This product is a PLEKHA6-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PLEKHA6 gene is associated with psychopathology and response to treatment in schizophrenic patients.The expression of PLEKHA6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PLEKHA6-shRNA-Seq1
Related Target/Protein PLEKHA6
Region CDS
TargetSeq CCAGCATTATGACGTGGACAT
NCBI RefSeq NM_014935
Alternative Names PEPP3; PEPP-3
Titer >1*10^10 GC/mL
Related Diseases Schizophrenic
Target Gene
Gene ID 22874
Uniprot ID Q9Y2H5

Related Products

Recombinant adenovirus, pU6-(Mouse SOX5), Overexpression (CAT#:AdV-GTOH0787WQ) Recombinant adenovirus, pU6-(Human hsa-mir-1228*), Overexpression (CAT#:AdV-GTOH0232WQ) Recombinant adenovirus, pU6-(Human hsa-let-7b), Overexpression (CAT#:AdV-GTOH0310WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Olfr559-shRNA-Seq4) (CAT#:AdV-SI2022WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Olfr1477-shRNA-Seq1) (CAT#:AdV-SI3969WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR52I1-shRNA-Seq7) (CAT#:AdV-SI1669WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(TTC21A-shRNA-Seq2) (CAT#:AdV-SI1291WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(RSBN1-shRNA-Seq1) (CAT#:AdV-SI0073WQ)