shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CCDC116-shRNA-Seq3)(CAT#: AdV-SI0609WQ)

This product is a CCDC116-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. A cis-eQTL genetic variant of the cancer-testis gene CCDC116 is associated with risk of multiple cancers. The expression of CCDC116-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CCDC116-shRNA-Seq3
Related Target/Protein CCDC116
Region CDS
TargetSeq GATGAGGACAAGGATGAGGAT
NCBI RefSeq NM_152612
Titer >1*10^10 GC/mL
Related Diseases colorectal cancer, breast cancer, esophageal cancer, gastric cancer
Target Gene
Gene ID 164592
Uniprot ID Q8IYX3

Related Products