shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(JMJD8-shRNA-Seq3)(CAT#: AdV-SI0656WQ)

This product is a JMJD8-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The JMJD8 gene functions as a positive regulator of TNF-induced NF-kappa-B signaling and regulates angiogenesis and cellular metabolism through interaction with PKM. The expression of JMJD8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert JMJD8-shRNA-Seq3
Related Target/Protein JMJD8
Region CDS
TargetSeq CAGAAGTGATCTACGGTCGTA
NCBI RefSeq NM_001005920
Alternative Names PP14397; C16orf20
Titer >1*10^10 GC/mL
Related Diseases Colorectal cancer
Target Gene
Gene ID 339123
Uniprot ID Q96S16

Related Products