shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LSM14B-shRNA-Seq2)(CAT#: AdV-SI0921WQ)
This product is a LSM14B-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The LSM14B gene may play a role in control of mRNA translation. The expression of LSM14B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | LSM14B-shRNA-Seq2 |
Related Target/Protein | LSM14B |
Region | CDS |
TargetSeq | GAGTGCAAATGCCCAGTTCAA |
NCBI RefSeq | NM_144703 |
Alternative Names | FT005; LSM13; FAM61B; RAP55B; C20orf40; bA11M20.3 Expression |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |