shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Lypd1-shRNA-Seq1)(CAT#: AdV-SI3126WQ)

This product is a Lypd1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Lypd1 gene may play a role in the intracellular trafficking of alpha-4:beta-2 and alpha-7-containing nAChRs and may inhibit their expression at the cell surface. The expression of Lypd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Lypd1-shRNA-Seq1
Related Target/Protein Lypd1
Region CDS
TargetSeq CAGAAAGAAGTGATGGAGCAA
NCBI RefSeq NM_145100
Alternative Names PHTS; LYPDC1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 116372
Uniprot ID Q8N2G4

Related Products