shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Lypd1-shRNA-Seq1)(CAT#: AdV-SI3126WQ)
This product is a Lypd1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Lypd1 gene may play a role in the intracellular trafficking of alpha-4:beta-2 and alpha-7-containing nAChRs and may inhibit their expression at the cell surface. The expression of Lypd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Lypd1-shRNA-Seq1 |
Related Target/Protein | Lypd1 |
Region | CDS |
TargetSeq | CAGAAAGAAGTGATGGAGCAA |
NCBI RefSeq | NM_145100 |
Alternative Names | PHTS; LYPDC1 |
Titer | >1*10^10 GC/mL |