shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PRDM15-shRNA-Seq2)(CAT#: AdV-SI0714WQ)
This product is a PRDM15-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PRDM15 gene plays a role as a molecular node in a transcriptional network regulating embryonic development and cell fate decision. The expression of PRDM15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | PRDM15-shRNA-Seq2 |
Related Target/Protein | PRDM15 |
Region | CDS |
TargetSeq | GCTCCTCAATGAACATCTGTT |
NCBI RefSeq | NM_022115 |
Alternative Names | PFM15; ZNF298; C21orf83 |
Titer | >1*10^10 GC/mL |
Related Diseases | Pancreatic cancer |