shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(ZNF280C-shRNA-Seq2)(CAT#: AdV-SI0945WQ)
This product is a ZNF280C-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The ZNF280C gene encodes a member of the zinc finger domain-containing protein family. The expression of ZNF280C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | ZNF280C-shRNA-Seq2 |
| Related Target/Protein | ZNF280C |
| Region | CDS |
| TargetSeq | GAGCCTTGCTTTGAAGAACAT |
| NCBI RefSeq | NM_017666 |
| Alternative Names | ZPET; SUHW3; ZNF633 |
| Titer | >1*10^10 GC/mL |
