shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(KIAA0930-shRNA-Seq1)(CAT#: AdV-SI0475WQ)
This product is a KIAA0930-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of KIAA0930-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | KIAA0930-shRNA-Seq1 |
Related Target/Protein | KIAA0930 |
Region | CDS |
TargetSeq | CGTCTTCTGGACTTGGATGTT |
NCBI RefSeq | NM_015264 |
Alternative Names | LSC3; C22orf9 |
Titer | >1*10^10 GC/mL |
Related Diseases | Melanoma |