shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Nudt16l1-shRNA-Seq1)(CAT#: AdV-SI2317WQ)

This product is a Nudt16l1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Nudt16l1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Nudt16l1-shRNA-Seq1
Related Target/Protein Nudt16l1
Region CDS
TargetSeq CCTTACCGAAGCTGATTACCT
NCBI RefSeq NM_025839
Alternative Names SDOS; TIRR
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84309
Uniprot ID Q9BRJ7

Related Products