shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(WDR62-shRNA-Seq2)(CAT#: AdV-SI2100WQ)

This product is a WDR62-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The WDR62 gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and cognitive disability. The expression of WDR62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert WDR62-shRNA-Seq2
Related Target/Protein WDR62
Region CDS
TargetSeq CAACACCATTCGCTTCTGGAA
NCBI RefSeq NM_173636
Alternative Names MCPH2; C19orf14
Titer >1*10^10 GC/mL
Related Diseases Microencephaly, cortical malformations, and cognitive disability
Target Gene
Gene ID 284403
Uniprot ID O43379

Related Products