shRNA Lentivirus (self-inactivating), p7SK-(F8-shRNA-Seq1)(CAT#: LV-SI1261WQ)
This product is a F8-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The F8 gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. The expression of F8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | F8-shRNA-Seq1 |
| Related Target/Protein | F8 |
| Region | CDS |
| TargetSeq | GCTCCTTTACTCAGCCCTTAT |
| NCBI RefSeq | NM_000132 |
| Alternative Names | AHF; F8B; F8C; HEMA; FVIII; DXS1253E |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hemophilia A, a common recessive X-linked coagulation disorder |
