shRNA Lentivirus (self-inactivating), p7SK-(FAM124A-shRNA-Seq2)(CAT#: LV-SI1288WQ)

This product is a FAM124A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. FAM124A belongs to the FAM124 family. The expression of FAM124A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert FAM124A-shRNA-Seq2
Related Target/Protein FAM124A
Region CDS
TargetSeq GAAAGCGGACTTCTGCATCTT
NCBI RefSeq NM_145019
Titer >1*10^10 GC/mL
Related Diseases Mycoplasma pneumoniae pneumonia
Target Gene
Gene ID 220108
Uniprot ID Q86V42

Related Products