shRNA Lentivirus (self-inactivating), p7SK-(Ola1-shRNA-Seq4)(CAT#: LV-SI3438WQ)

This product is a Ola1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Ola1 gene encodes a member of the GTPase protein family and interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. The expression of Ola1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Ola1-shRNA-Seq4
Related Target/Protein Ola1
Region 3UTR
TargetSeq CATGGGAATTAGAAGAAGAAT
NCBI RefSeq NM_025942
Alternative Names DOC45; GBP45; GTBP9; GTPBP9; PTD004
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 29789
Uniprot ID Q9NTK5

Related Products