shRNA Lentivirus (self-inactivating), p7SK-(Ola1-shRNA-Seq4)(CAT#: LV-SI3438WQ)
This product is a Ola1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Ola1 gene encodes a member of the GTPase protein family and interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. The expression of Ola1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Ola1-shRNA-Seq4 |
Related Target/Protein | Ola1 |
Region | 3UTR |
TargetSeq | CATGGGAATTAGAAGAAGAAT |
NCBI RefSeq | NM_025942 |
Alternative Names | DOC45; GBP45; GTBP9; GTPBP9; PTD004 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |