shRNA Lentivirus (self-inactivating), pU6-(C10orf27-shRNA-Seq1)(CAT#: LV-SI0479WQ)

This product is a C10orf27-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C10orf27 gene encodes a protein that regulates thymic epithelial cell proliferation and thymus size. It has been identified as a ligand for the class I human leukocyte antigen (HLA-I) in thymus. The expression of C10orf27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C10orf27-shRNA-Seq1
Related Target/Protein C10orf27
Region CDS
TargetSeq GAGTACATTGGAGAAGCTCAA
NCBI RefSeq NM_152710
Alternative Names SPATIAL; TBATA
Titer >1*10^10 GC/mL
Related Diseases Multiple sclerosis (MS)
Target Gene
Gene ID 219793
Uniprot ID Q96M53

Related Products