shRNA Lentivirus (self-inactivating), pU6-(C20orf43-shRNA-Seq1)(CAT#: LV-SI0359WQ)
This product is a C20orf43-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C20orf43 gene is required for ATR pathway signaling upon DNA damage and has a positive activity during DNA replication. The expression of C20orf43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C20orf43-shRNA-Seq1 |
Related Target/Protein | C20orf43 |
Region | CDS |
TargetSeq | GTTGAGAAGGTCGACAAAGAT |
NCBI RefSeq | NM_016407 |
Alternative Names | CDAO5; RTFDC1; HSPC164; RTF2; SHUJUN-3 |
Titer | >1*10^10 GC/mL |