shRNA Lentivirus (self-inactivating), pU6-(Med25-shRNA-Seq1)(CAT#: LV-SI2221WQ)

This product is a Med25-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Med25 gene plays a role in chromatin modification and in preinitiation complex assembly. Mutations in this gene are associated with Charcot-Marie-Tooth disease type 2B2. The expression of Med25-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Med25-shRNA-Seq1
Related Target/Protein Med25
Region CDS
TargetSeq GCAGCTGTTCGATGACTTTAA
NCBI RefSeq NM_029365
Alternative Names P78; ACID1; ARC92; BVSYS; PTOV2; CMT2B2; TCBAP0758
Titer >1*10^10 GC/mL
Related Diseases Charcot-Marie-Tooth disease type 2B2
Target Gene
Gene ID 81857
Uniprot ID Q71SY5

Related Products