shRNA Lentivirus (self-inactivating), pU6-(RPRM-shRNA-Seq3)(CAT#: LV-SI0412WQ)
This product is a RPRM-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The RPRM gene may be involved in the regulation of p53-dependent G2 arrest of the cell cycle. The expression of RPRM-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | RPRM-shRNA-Seq3 |
Related Target/Protein | RPRM |
Region | 3UTR |
TargetSeq | CAGACTCTGAACTCAGCAGAA |
NCBI RefSeq | NM_019845 |
Alternative Names | REPRIMO |
Titer | >1*10^10 GC/mL |
Related Diseases | Lung carcinoma |