shRNA Adeno-associated Virus Serotype 2, p7SK-(C1orf212-shRNA-Seq2)(CAT#: AAV-SI1293WQ)

This product is a C1orf212-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C1orf212-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C1orf212-shRNA-Seq2
Related Target/Protein C1orf212
Region CDS
TargetSeq CCACATCTAATTGGCTTTGTT
NCBI RefSeq NM_138428
Alternative Names SMIM12
Titer >1*10^10 GC/mL
Target Gene
Gene ID 113444
Uniprot ID Q96EX1

Related Products