shRNA Adeno-associated Virus Serotype 2, p7SK-(COG6-shRNA-Seq1)(CAT#: AAV-SI3989WQ)
This product is a COG6-shRNA encoding AAV, which is based on AAV-2 serotype. The COG6 gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The expression of COG6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | COG6-shRNA-Seq1 |
Related Target/Protein | COG6 |
Region | CDS |
TargetSeq | CGTGGAGATATTGAACGTAAA |
NCBI RefSeq | NM_020751 |
Alternative Names | COD2; SHNS; CDG2L |
Titer | >1*10^10 GC/mL |