shRNA Adeno-associated Virus Serotype 2, p7SK-(COG6-shRNA-Seq1)(CAT#: AAV-SI3989WQ)

This product is a COG6-shRNA encoding AAV, which is based on AAV-2 serotype. The COG6 gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The expression of COG6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert COG6-shRNA-Seq1
Related Target/Protein COG6
Region CDS
TargetSeq CGTGGAGATATTGAACGTAAA
NCBI RefSeq NM_020751
Alternative Names COD2; SHNS; CDG2L
Titer >1*10^10 GC/mL
Target Gene
Gene ID 57511
Uniprot ID Q9Y2V7

Related Products