shRNA Adeno-associated Virus Serotype 2, p7SK-(KIAA0495-shRNA-Seq1)(CAT#: AAV-SI1427WQ)

This product is a KIAA0495-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of KIAA0495-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert KIAA0495-shRNA-Seq1
Related Target/Protein KIAA0495
Region CDS
TargetSeq CAAGTAAAGATACCAGCAGTG
NCBI RefSeq NM_207306
Alternative Names PDAM; TP73-AS1
Titer >1*10^10 GC/mL
Related Diseases Oligodendroglial tumors
Target Gene
Gene ID 57212
Uniprot ID A0A024R4G0

Related Products

Inquiry Now
Advertisement