shRNA Adeno-associated Virus Serotype 2, p7SK-(MRPS26-shRNA-Seq3)(CAT#: AAV-SI1404WQ)

This product is a MRPS26-shRNA encoding AAV, which is based on AAV-2 serotype. Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. The expression of MRPS26-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert MRPS26-shRNA-Seq3
Related Target/Protein MRPS26
Region 3UTR
TargetSeq CCATGTATGTATCATGGCGGA
NCBI RefSeq NM_030811
Alternative Names GI008; MRPS13; RPMS13; MRP-S13; MRP-S26; NY-BR-87; C20orf193; dJ534B8.3
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 64949
Uniprot ID Q9BYN8

Related Products

Inquiry Now
Advertisement