shRNA Adeno-associated Virus Serotype 2, p7SK-(N4bp2l2-shRNA-Seq3)(CAT#: AAV-SI3618WQ)
This product is a N4bp2l2-shRNA encoding AAV, which is based on AAV-2 serotype. The N4bp2l2 gene has enzyme binding and transcription corepressor activity. The expression of N4bp2l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | N4bp2l2-shRNA-Seq3 |
Related Target/Protein | N4bp2l2 |
Region | CDS |
TargetSeq | CCAAGGATGATGAAATCTATA |
NCBI RefSeq | NM_201369 |
Alternative Names | CG005; CG016; PFAAP5; 92M18.3 |
Titer | >1*10^10 GC/mL |